Search Result

Results for "

protein sequence

" in MedChemExpress (MCE) Product Catalog:

By Targets:	Akt (1) Amyloid-β (2) Apoptosis (3) Bacterial (1) Bcl-2 Family (1) Biochemical Assay Reagents (1) Endogenous Metabolite (1) Eukaryotic Initiation Factor (eIF) (1) Fluorescent Dye (2) HBV (2) HIV (1) Integrin (1) MDM-2/p53 (1) PD-1/PD-L1 (1) PKC (1) SARS-CoV (1) Thrombin (1) VEGFR (2)
By Research Areas:	Cancer (13) Cardiovascular Disease (3) Infection (3) Inflammation/Immunology (3) Neurological Disease (8)

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

Natural
Products

Recombinant Proteins

Antibodies

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-P0315

Crosstide

1 Publications Verification

Akt Others

Crosstide is a peptide analog of glycogen synthase kinase α/β fusion protein sequence which is a substrate for Akt.

Crosstide 1 Publications Verification	Akt	Others
Crosstide is a peptide analog of glycogen synthase kinase α/β fusion protein sequence which is a substrate for Akt.

HY-P3732

RGD-4C	Integrin	Cancer
RGD-4C is a arginine-glycine-aspartic acid peptide (ACDCRGDCFC) with integrin binding activity. The Arg-Gly-Asp (RGD) sequence serves as the primary integrin recognition site in extracellular matrix proteins, and peptides containing this sequence can mimic the recognition specificity of the matrix proteins. RGD-4C is a αv-integrin ligand, can conjugate with bioactive molecule to exert antitumor effects in animal models .

HY-157881

2-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O) β-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O)	Biochemical Assay Reagents	Others
2-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O) is a biochemical reagent that can be used for protein sequence analysis .

HY-130533

ReAsH-EDT2	Fluorescent Dye	Others
ReAsH-EDT2 is a red fluorescent dye that marks proteins. ReAsH-EDT2 is a membrane-permeable biarsenical compound that binds covalently to tetracysteine sequences which allows the protein to be imaged. ReAsH-EDT2 can be used for protein localization and trafficking. (λ_ex=530 nm, λ_em=592 nm) .

HY-P4808

PHF6	Amyloid-β	Neurological Disease
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .

HY-114164

Thrombin (MW 37kDa) 5 Publications Verification	Thrombin	Neurological Disease
Thrombin (MW 37kDa) is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins.

HY-105174

BPC 157	Endogenous Metabolite	Inflammation/Immunology
BPC 157 is a stable gastric pentadecapeptide and a partial sequence of the human gastric juice protein BPC. BPC 157 is an anti-ulcer peptidergic agent with no reported toxicity. BPC 157 links inflammatory bowel disease and multiple sclerosis .

HY-100758

FUBP1-IN-1	Others	Cancer
FUBP1-IN-1 is a potent *FUSE binding protein* 1 (FUBP1)** inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC₅₀ value of 11.0 μM .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-117695

AQC 2 Publications Verification 6-Aminoquinolyl-N-hydroxysccinimidyl carbamate	Fluorescent Dye	Others
AQC (6-Aminoquinolyl-N-hydroxysccinimidyl carbamate) is a reagent used for amino acid or protein sequence analysis by HPLC with fluorescence detection. AQC reacts with primary and secondary amino acids to yield fluorescent derivates, allowing amino acid detection at under-picomolar levels .

HY-155990

Chb-M′ RUNX-IN-1	Apoptosis	Cancer
Chb-M′ (Compound Conjugate 1) covalently binds to the RUNX-binding sequences, and inhibits the binding of RUNX proteins to their target sites. Chb-M′ induces the p53-dependent apoptosis and inhibits cancer cell growth. Chb-M′ inhibits tumor growth in PANC-1 xenograft mice .

HY-149489

JH-131e-153	Others	Neurological Disease
JH-131e-153, a diacylglycerol (DAG)-lactone, is a small molecule activator of Munc13-1, targeting the C1 domain. The activation sequence of JH-131e-153 on Munc13-1 is WT>I590≈R592A≈W588A. The C1 domain of Munc13-1 and protein kinase C (PKC) are homologous in sequence and structure. The activation sequence of JH-131e-153 on Munc13-1 and PKC was PKCα>Munc13-1>PKCε. JH-131e-153 regulates neuronal processes through Munc13-1 and can be further used in the study of neurodegenerative diseases .

HY-P5370

Scrambled β-amyloid (1-40)	Amyloid-β	Others
Scrambled β-amyloid (1-40) is a biological active peptide. (Aβ (1-40) together with Aβ (1-42) are two major C-terminal variants of the Aβ protein constituting the majority of Aβs. These undergo post-secretory aggregation and deposition in the Alzheimer’s disease brain. This peptide is the scrambled sequence of Abeta 1-40 HY-P0265)

HY-101931

hVEGF-IN-1	VEGFR	Cancer
hVEGF-IN-1, a quinazoline derivative, could specifically bind to the G-rich sequence in the internal ribosome entry site A (IRES-A) and destabilize the G-quadruplex structure. hVEGF-IN-1 binds to the IRES-A (WT) with a K_d of 0.928 μM in SPR experiments. hVEGF-IN-1 could hinder tumor cells migration and repress tumor growth by decreasing VEGF-A protein expression .

HY-155991

RUNX-IN-2	Apoptosis	Cancer
RUNX-IN-2 (Compound Conjugate 3) covalently binds to the RUNX-binding sequences, and inhibits the binding of RUNX proteins to their target sites. RUNX-IN-2 induces the p53-dependent apoptosis and inhibits cancer cell growth. RUNX-IN-2 inhibits tumor growth in PANC-1 xenograft mice. RUNX-IN-2 has high alkylation efficiency and specificity .

HY-P5483

Retro-indolicidin	Bacterial	Others
Retro-indolicidin is a biological active peptide. (Reverse peptide of indolicidin (Rev4) is a 13-amino acid residue peptide based on the sequence of indolicidin. Indolicidin, a member of the cathelicidin protein family, is a 13-amino acid residue cationic, antimicrobial peptide-amide isolated from the cytoplasmic granules of bovine neutrophils. The synthetic peptide Rev4 has been shown to possess strong antimicrobial as well as protease inhibitory activities in vitro.)

HY-112163

Zotatifin 5 Publications Verification eFT226	Eukaryotic Initiation Factor (eIF) SARS-CoV Apoptosis	Infection Cancer
Zotatifin (eFT226) is a potent, selective, and well-tolerated eIF4A inhibitor. Zotatifin promotes eIF4A binding to specific mRNA sequences with recognition motifs in the 5’-UTRs (IC₅₀=2 nM) and interferes with the assembly of the eIF4F initiation complex . Zotatifin shows robust antiviral effects, it effectively reduces viral infectivity by inhibiting SARS-CoV-2 NP protein biogenesis (IC₉₀=37 nM) . Zotatifin induces cell apoptosis .

HY-P990088

Sotiburafusp alfa	VEGFR PD-1/PD-L1	Cardiovascular Disease
Sotiburafusp alfa is a bispecific fusion protein, which is a humanized VEGFR-1 extracellular domain fragment (129-228, 1-100 in the current sequence) fused via the peptide linker ¹⁰¹GGSGGSGGSGGSGGS ¹¹⁵ to the N-terminus of the heavy chain (116-564) of a humanized IgG1-kappa anti-human PD-L1 heavy chain variant L352>A, L353>A. Sotiburafusp alfa is also an angiogenesis inhibitor .

HY-P5395

TAT-GluR23A Fusion Peptide	HIV	Others
TAT-GluR23A Fusion Peptide is a biological active peptide. (This is the GluR23A sequence, a control inactive peptide used as a mutant counterpart to glutamate receptor endocytosis inhibitor (GluR23Y), connected to an 11 amino acid cell permeable HIV Trans-Activator of Transcription (TAT) protein transduction domain (PTD). GluR23A is derived from GluR23Y amino acids 869 to 877, with Ala substituted for Tyr, and thus lacking essential phosphorylation sites.Control peptide of HY-P2259)

HY-P5439

Epsilon-V1-2, Cys-conjugated	PKC	Others
Epsilon-V1-2, Cys-conjugated is a biological active peptide. (This peptide is the εPKC specific inhibitor. Its inhibitory activity is based on εPKC translocation and MARCKS phosphorylation. This peptide interferes with εPKC interaction with the anchoring protein εRACK. This peptide contains a cysteine residue added to the C-terminus for potential S-S bond formation with a carrier protein.Pyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

HY-153843

RNA Aptamer Corn sodium	Others	Others
RNA Aptamer Corn (sodium) is a 28-nt-long aptamer that is substantially shorter than Spinach and Spinach2 and exhibits bright red fluorescence upon binding DFHO (a soluble analog of the intrinsic fluorophore of red fluorescent protein), RNA Aptamer Corn (sodium) can be used to visualize RNA expression or localization in live cells which have been soaked with chromophores. The Corn-DFHO does not become appreciably cytotoxic when illuminated. And most importantly, Corn-DFHO exhibits markedly increased photostability compared to other aptamer-chromophore complexes both in vitro and in vivo. (36 nt Corn construct: 5'-GGCGCGAGGAAGGAGGUCUGAGGAGGUCACUGCGCC-3'; A 36-nt RNA construct, comprised of the 28-nt minimal Corn sequence extended proximally with a 4 base-pair stem.)

HY-122578

P53R3	MDM-2/p53	Cancer
P53R3 is a potent p53 reactivator and restores sequence-specific DNA binding of p53 hot spot mutants, including p53 ^R175H, p53 ^R248W and p53 ^R273H. P53R3 induces p53-dependent antiproliferative effects with much higher specificity than PRIMA-1. P53R3 enhances the recruitment of wild-type p53 and p53 ^M237I to several target gene promoters. P53R3 strongly enhances the mRNA, total protein and cell surface expression of the death receptor death receptor 5 (DR5). P53R3 is used for cancer research .

HY-P5325

Bid BH3 (80-99)	Bcl-2 Family	Others
Bid BH3 (80-99) is a biological active peptide. (BID is a pro-apoptotic member of the 'BH3-only' (BOPS) subset of the BCL-2 family of proteins that constitute a critical control point in apoptosis. Bid is the first of the BOPs reported to bind and activate Bcl-2, Bax, and Bak. Bid serves as a death-inducing ligand that moves from the cytosol to the mitochondrial membrane to inactivate Bcl-2 or to activate Bax.Pyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

Epigenetics Compound Library	1249 compounds
Epigenetics refers to changes in phenotype that are not rooted in DNA sequence. Many types of epigenetic processes have been identified, including DNA methylation, alteration in the structure of histone proteins and gene regulation by small noncoding microRNAs. Modification of DNA, protein, or RNA, resulting in changes to the function and/or regulation of these molecules, without altering their primary sequences, reveals the complexities of cellular differentiation, embryology, the regulation of gene expression, aging, cancer, and other diseases. MCE provide a unique collection of 1249 epigenetics-related compounds that can be used in the research of the related diseases.

AQC 2 Publications Verification 6-Aminoquinolyl-N-hydroxysccinimidyl carbamate	Fluorescent Dyes/Probes
AQC (6-Aminoquinolyl-N-hydroxysccinimidyl carbamate) is a reagent used for amino acid or protein sequence analysis by HPLC with fluorescence detection. AQC reacts with primary and secondary amino acids to yield fluorescent derivates, allowing amino acid detection at under-picomolar levels .

ReAsH-EDT2	Protein Labeling
ReAsH-EDT2 is a red fluorescent dye that marks proteins. ReAsH-EDT2 is a membrane-permeable biarsenical compound that binds covalently to tetracysteine sequences which allows the protein to be imaged. ReAsH-EDT2 can be used for protein localization and trafficking. (λ_ex=530 nm, λ_em=592 nm) .

2-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O) β-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O)	Buffer Reagents
2-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O) is a biochemical reagent that can be used for protein sequence analysis .

Cat. No.	Product Name	Target	Research Area

HY-P0315

Crosstide

1 Publications Verification

Akt Others

Crosstide is a peptide analog of glycogen synthase kinase α/β fusion protein sequence which is a substrate for Akt.

Crosstide 1 Publications Verification	Akt	Others
Crosstide is a peptide analog of glycogen synthase kinase α/β fusion protein sequence which is a substrate for Akt.

HY-P0329

X-press Tag Peptide	Peptides	Others
X-press Tag Peptide is a tag peptide used for protein purification. X-press Tag is also an N-terminal leader peptide; this N-terminal peptide contains a polyhistidine sequence, the Xpress epitope (part of bacteriophage T7 gene 10 protein) and an enterokinase cleavage site. Anti-Xpress antibodies recognize the Xpress epitope sequence found in this leader peptide.

HY-P4749

Prion Protein (106-126) (human) (scrambled)	Peptides	Neurological Disease
Prion Protein (106-126) (human) (scrambled) is a scrambled sequence of Prion Protein (106-126). Prion Protein (106-126) (human) (scrambled) with a random sequence of the amino acids that are the same as the active fragment. Prion Protein (106-126) (human) (scrambled) usually used as a negative control .

HY-P4808

PHF6	Amyloid-β	Neurological Disease
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P1734

Ac-MBP (1-11)

Peptides Neurological Disease

Ac-MBP 1-11, a short peptide sequence, is the major encephalitogenic epitope in myelin basic protein (MBP) .

Ac-MBP (1-11)	Peptides	Neurological Disease
Ac-MBP 1-11, a short peptide sequence, is the major encephalitogenic epitope in myelin basic protein (MBP) .

HY-P1849

JAG-1, scrambled scJag-1	Peptides	Cardiovascular Disease
JAG-1, scrambled (scJag-1) is a scrambled sequence of JAG-1 (Jagged-1 protein). JAG-1, scrambled has a random sequence of the amino acids that are the same as the active fragment. JAG-1, scrambled is usually used as a negative control .

HY-P3732

RGD-4C	Integrin	Cancer
RGD-4C is a arginine-glycine-aspartic acid peptide (ACDCRGDCFC) with integrin binding activity. The Arg-Gly-Asp (RGD) sequence serves as the primary integrin recognition site in extracellular matrix proteins, and peptides containing this sequence can mimic the recognition specificity of the matrix proteins. RGD-4C is a αv-integrin ligand, can conjugate with bioactive molecule to exert antitumor effects in animal models .

HY-P1849A

JAG-1, scrambled TFA scJag-1 TFA	Peptides	Cardiovascular Disease
JAG-1, scrambled (scJag-1) TFA is a scrambled sequence of JAG-1 (Jagged-1 protein). JAG-1, scrambled TFA has a random sequence of the amino acids that are the same as the active fragment. JAG-1, scrambled TFA is usually used as a negative control .

HY-P3935

Arg-Gly-Tyr-Ser-Leu-Gly	Peptides	Cancer
Arg-Gly-Tyr-Ser-Leu-Gly is corresponding to the sequence of residues from 21 through 26 in lysozyme. Arg-Gly-Tyr-Ser-Leu-Gly can be used as a substrate for the protein kinase, and phosphorylated at serine residue by protein kinase .

HY-P5430

DYRKtide	Peptides	Others
DYRKtide is a biological active peptide. (Dyrktide is designed as the optimal substrate sequence efficiently phosphorylated by DYRK1A, which is a dual-specificity protein kinase that is thought to be involved in brain development.)

HY-105174

BPC 157	Endogenous Metabolite	Inflammation/Immunology
BPC 157 is a stable gastric pentadecapeptide and a partial sequence of the human gastric juice protein BPC. BPC 157 is an anti-ulcer peptidergic agent with no reported toxicity. BPC 157 links inflammatory bowel disease and multiple sclerosis .

HY-P3541

Dirucotide MBP8298	Peptides	Neurological Disease Inflammation/Immunology
Dirucotide (MBP8298) is a synthetic peptide that consists of 17 amino acids linked in a sequence identical to that of a portion of human myelin basic protein. Dirucotide can be used for the research in autoimmune disorder of the central nervous system, such as Multiple sclerosis (MS) .

HY-P3817

Des-[Gly77,His78] Myelin Basic Protein (68-84), bovine	Peptides	Neurological Disease
Des-[Gly77,His78] Myelin Basic Protein (68-84) is a 68-84 sequence fragment of guinea pig myelin basic protein (GPMBP). Des-[Gly77,His78] Myelin Basic Protein (68-84) regulates functionally diverse encephalitogenic and proliferative activities of experimental autoimmune encephalomyelitis (EAE)-associated T cells .

HY-P3509

PNC-28	Peptides	Cancer
PNC-28 is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 can be used for pancreatic cancer research .

HY-P3509A

PNC-28 acetate	Peptides	Cancer
PNC-28 acetate is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 acetate can be used for pancreatic cancer research .

HY-P1610

Asudemotide	Peptides	Cancer
Asudemotide (S-588410) is a peptide of human DEP domain-containing protein 1A. Asudemotide is an immunostimulant. Asudemotide has a sequence of H-Glu-Tyr-Tyr-Glu-Leu-Phe-Val-Asn-Ile-OH. Asudemotide induces a tumor immune response in esophageal cancer. .

HY-115379

Latromotide	Peptides	Cancer
Latromotide is a synthetic peptide with antineoplastic activity. It consists of 10 amino acids corresponding to amino acid residues 66-75 of the human kinesin-like protein KIF20A. Latromotide has a sequence of H-Lys-Val-Tyr-Leu-Arg-Val-Arg-Pro Leu-Leu-OH .

HY-P5344

Dabcyl-LNKRLLHETQ-Edans Fluorigenic PEXEL peptide	Peptides	Others
Dabcyl-LNKRLLHETQ-Edans (Fluorigenic PEXEL peptide) is a biological active peptide. (This FRET substrate peptide for Plasmepsin V (PMV) is derived from the conserved Plasmodium Export Element (PEXEL) motif of Histidine-Rich Protein II (HRPII). PMV is an ER aspartic protease that recognizes and cleaves the RXL sequence within the PEXEL motif of proteins exported by human malaria parasite Plasmodium falciparum, allowing them to translocate into host erythrocytes.)

HY-P3051

CKS-17	Peptides	Inflammation/Immunology
CKS-17 is a synthetic retroviral envelope peptide. CKS-17 has the highly conserved amino acid sequences occurring within the transmembrane envelope protein of many animal and human retroviruses. CKS-17 acts as an immunomodulatory epitope and exhibits suppressive properties for numerous immune functions .

HY-P5370

Scrambled β-amyloid (1-40)	Amyloid-β	Others
Scrambled β-amyloid (1-40) is a biological active peptide. (Aβ (1-40) together with Aβ (1-42) are two major C-terminal variants of the Aβ protein constituting the majority of Aβs. These undergo post-secretory aggregation and deposition in the Alzheimer’s disease brain. This peptide is the scrambled sequence of Abeta 1-40 HY-P0265)

HY-P4873

Amylin (20-29) (human)	Peptides	Neurological Disease
Amylin (20-29) (human) is the fragment of human islet amyloid polypeptide (hIAPP) or Amylin. Amylin is a 37-residue hormone. Amylin (20-29) (human) is responsible for the amyloidogenic propensities of the full length protein. Amylin (20-29) (human) can be transformed into its corresponding peptoid and retropeptoid sequences, to obtain beta-sheet breaker peptides as amyloid inhibitors .

HY-P5483

Retro-indolicidin	Bacterial	Others
Retro-indolicidin is a biological active peptide. (Reverse peptide of indolicidin (Rev4) is a 13-amino acid residue peptide based on the sequence of indolicidin. Indolicidin, a member of the cathelicidin protein family, is a 13-amino acid residue cationic, antimicrobial peptide-amide isolated from the cytoplasmic granules of bovine neutrophils. The synthetic peptide Rev4 has been shown to possess strong antimicrobial as well as protease inhibitory activities in vitro.)

HY-P10055

PSMA targeting peptide PSMA-1	Peptides	Cancer
PSMA-1 is a PSMA targeting peptide (GRFLTGGTGRLLRIS) and can be used for for targeted delivery of glucose-regulated protein (GRP)-silencing siRNAs in PCa cells.?PSMA-1 is selected and polyarginine sequences R6?or R9?were added at the C terminus to generate the CTPs. FITC labeling of the peptide with an aminohexanoic acid (Ahx) linker at the N terminus produced FITC-PSMA-1, to track PSMA binding on PCa cells .?

HY-P5395

TAT-GluR23A Fusion Peptide	HIV	Others
TAT-GluR23A Fusion Peptide is a biological active peptide. (This is the GluR23A sequence, a control inactive peptide used as a mutant counterpart to glutamate receptor endocytosis inhibitor (GluR23Y), connected to an 11 amino acid cell permeable HIV Trans-Activator of Transcription (TAT) protein transduction domain (PTD). GluR23A is derived from GluR23Y amino acids 869 to 877, with Ala substituted for Tyr, and thus lacking essential phosphorylation sites.Control peptide of HY-P2259)

HY-P5439

Epsilon-V1-2, Cys-conjugated	PKC	Others
Epsilon-V1-2, Cys-conjugated is a biological active peptide. (This peptide is the εPKC specific inhibitor. Its inhibitory activity is based on εPKC translocation and MARCKS phosphorylation. This peptide interferes with εPKC interaction with the anchoring protein εRACK. This peptide contains a cysteine residue added to the C-terminus for potential S-S bond formation with a carrier protein.Pyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

HY-P5429

DNA-PK Substrate	Peptides	Others
DNA-PK Substrate is a biological active peptide. (A substrate for DNA-dependent protein kinase (DNA-PK), phosphorylation. DNA-PK is essential for the repair of DNA double-strand breaks. This peptide corresponding to 11–24 amino acids of human p53 with threonine 18 and serine 20 changed to alanine is used as a substrate for the assay of DNA-PK activityPyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

HY-P5325

Bid BH3 (80-99)	Bcl-2 Family	Others
Bid BH3 (80-99) is a biological active peptide. (BID is a pro-apoptotic member of the 'BH3-only' (BOPS) subset of the BCL-2 family of proteins that constitute a critical control point in apoptosis. Bid is the first of the BOPs reported to bind and activate Bcl-2, Bax, and Bak. Bid serves as a death-inducing ligand that moves from the cytosol to the mitochondrial membrane to inactivate Bcl-2 or to activate Bax.Pyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

Species:	Human (19) Mouse (1) Cynomolgus (1)
Tag:	T7 (1) His (13) Tag Free (1) Avi (1) Myc (3) GST (3) Fc (4)
Source:	HEK293 (12) Sf9 insect cells (1) P. pastoris (1) E. coli (7)

Cat. No.	Compare	Product Name	Species	Source

HY-P700271

	BCAS2 Protein, Human (N-GST) rHuBCAS2, His, N-T7; Pre-mRNA-Splicing Factor SPF27; Breast Carcinoma-Amplified sequence 2; Spliceosome-Associated protein SPF 27; BCAS2	Human	E. coli
	BCAS2 is essential for pre-mRNA splicing and is critical for spliceosome activation as a key component of the activated spliceosome and the PRP19-CDC5L complex. It may act as a scaffold in spliceosome assembly, forming contacts with core components. BCAS2 Protein, Human (N-GST) is the recombinant human-derived BCAS2 protein, expressed by E. coli , with N-GST labeled tag. The total length of BCAS2 Protein, Human (N-GST) is 224 a.a., with molecular weight of ~53 kDa.

HY-P76686

	TSPAN31 Protein, Human (HEK293, Fc) Tetraspanin-31; Tspan-31; Sarcoma-amplified sequence; SAS	Human	HEK293
	TSPAN31 is a member of the tetraspanin protein family, which has four hydrophobic domains. TSPAN31 mediates signal transduction events and plays a role in the regulation of cell development, activation, growth, and movement. TSPAN31 is also associated with tumorigenesis and osteosarcoma. TSPAN31 Protein, Human (HEK293, Fc) is the recombinant human-derived TSPAN31 protein, expressed by HEK293 , with N-mFc labeled tag. The total length of TSPAN31 Protein, Human (HEK293, Fc) is 80 a.a., with molecular weight of 40-46 kDa.

HY-P70157

	MICA Protein, Human (285a.a, HEK293, His) rHuMHC class I polypeptide-related sequence A/MICA, His ; MHC Class I Polypeptide-Related sequence A; MIC-A; MICA; PERB11.1	Human	HEK293
	MICA is a ligand for the stress signaling protein and natural killer (NK) cell activating receptor KLRK1/NKG2D. Tumor cells shed the expressed MICA protein and undergo immune evasion. MICA Protein, Human (285a.a, HEK293, His) is the recombinant human-derived MICA protein, expressed by HEK293 , with C-6*His labeled tag. The total length of MICA Protein, Human (285a.a, HEK293, His) is 285 a.a., with molecular weight of ~60.0 kDa.

HY-P7649

	BCAS2 Protein, Human (His, T7) rHuBCAS2, His, N-T7; Pre-mRNA-Splicing Factor SPF27; Breast Carcinoma-Amplified sequence 2; Spliceosome-Associated protein SPF 27; BCAS2	Human	E. coli
	BCAS2 Protein, Human (His, T7) plays crucial roles in pre-mRNA splicing and androgen receptor transcription. BCAS2 helps repair radiation-induced DSBs efficiently in both human PCa cells and Drosophila.

HY-P73294

	MICB Protein, Human (HEK293, His) MHC class I polypeptide-related sequence B; MIC-B; PERB11.2	Human	HEK293
	MICB Protein, a heavily glycosylated ligand for NKG2D receptor, triggers cytolytic response in immune cells. It resembles MHC class I molecules but lacks association with beta-2-microglobulin or peptide binding. Alternative splicing leads to multiple transcript variants. MICB is widely expressed, especially in lymph nodes and bone marrow, highlighting its immune response role in diverse physiological contexts. MICB Protein, Human (HEK293, His) is the recombinant human-derived MICB protein, expressed by HEK293 , with C-His, C-6*His labeled tag. The total length of MICB Protein, Human (HEK293, His) is 276 a.a., with molecular weight of ~45 kDa.

HY-P75928

MICA Protein, Cynomolgus (HEK293, His)

MHC class I polypeptide-related sequence A; MIC-A; PERB11.1
Cynomolgus HEK293

HY-P70579

	MICA Protein, Human (HEK293, Fc) MHC Class I Polypeptide-Related sequence A; MIC-A; MICA; PERB11.1	Human	HEK293
	MICA is a ligand for the stress signaling protein and natural killer (NK) cell activating receptor KLRK1/NKG2D. Tumor cells shed the expressed MICA protein and undergo immune evasion. MICA Protein, Human (HEK293, Fc) is the recombinant human-derived MICA protein, expressed by HEK293 , with C-hFc labeled tag. The total length of MICA Protein, Human (HEK293, Fc) is 285 a.a., with molecular weight of 85-110 kDa.

HY-P73293

	MICB Protein, Human (HEK293, His-Fc) MHC class I polypeptide-related sequence B; MIC-B; PERB11.2	Human	HEK293
	In contrast to antigen presentation, MICB proteins serve as stress-induced autoantigens and are recognized by γδ T cells. As a ligand for the KLRK1/NKG2D receptor, binding of MICB results in cell lysis. MICB Protein, Human (HEK293, His-Fc) is the recombinant human-derived MICB protein, expressed by HEK293 , with C-hFc, C-His labeled tag. The total length of MICB Protein, Human (HEK293, His-Fc) is 298 a.a., with molecular weight of 80-90 kDa.

HY-P700587

	AXL Protein, Human (HEK293, C-His) AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene	Human	HEK293
	AXL protein is a receptor tyrosine kinase that mediates signals by binding to GAS6 and regulates cell survival, proliferation, migration and differentiation. After ligand binding, AXL dimerizes and autophosphorylates, activating downstream molecules, such as PI3 kinase subunits, GRB2, PLCG1, etc. AXL Protein, Human (HEK293, C-His) is the recombinant human-derived AXL protein, expressed by HEK293 , with C-10*His labeled tag. The total length of AXL Protein, Human (HEK293, C-His) is 426 a.a., with molecular weight of 48.9 kDa.

HY-P700585

	AXL Protein, Human (D266N, HEK293, His) AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene	Human	HEK293
	AXL Protein, a receptor tyrosine kinase, mediates signals by binding GAS6, regulating cell survival, proliferation, migration, and differentiation. Upon ligand binding, AXL undergoes dimerization and autophosphorylation, activating downstream molecules like PI3-kinase subunits, GRB2, PLCG1, and more. This triggers AKT kinase activation, influencing processes such as endothelial cell survival, cytokine signaling in NK cell development, hepatic regeneration, gonadotropin-releasing hormone neuron function, platelet activation, thrombotic responses, and immune modulation. AXL also serves as a receptor for lassa virus and lymphocytic choriomeningitis virus during microbial infection. AXL Protein, Human (D266N, HEK293, His) is the recombinant human-derived AXL protein, expressed by HEK293 , with C-10*His labeled tag and D266N mutation. The total length of AXL Protein, Human (D266N, HEK293, His) is 426 a.a., with molecular weight of 48.9 kDa.

HY-P700586

	AXL Protein, Human (D266N, HEK293, hFc) AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene	Human	HEK293
	AXL Protein, a receptor tyrosine kinase, mediates signals by binding GAS6, regulating cell survival, proliferation, migration, and differentiation. Upon ligand binding, AXL undergoes dimerization and autophosphorylation, activating downstream molecules like PI3-kinase subunits, GRB2, PLCG1, and more. This triggers AKT kinase activation, influencing processes such as endothelial cell survival, cytokine signaling in NK cell development, hepatic regeneration, gonadotropin-releasing hormone neuron function, platelet activation, thrombotic responses, and immune modulation. AXL also serves as a receptor for lassa virus and lymphocytic choriomeningitis virus during microbial infection. AXL Protein, Human (D266N, HEK293, hFc) is the recombinant human-derived AXL protein, expressed by HEK293 , with C-hFc labeled tag and D266N mutation. The total length of AXL Protein, Human (D266N, HEK293, hFc) is 426 a.a., with molecular weight of 75.1 kDa.

HY-P702703

	AXL Protein, Human (Biotinylated, sf9, GST, Avi) AXL; AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene	Human	Sf9 insect cells

HY-P71639

	CORS26 Protein, Mouse (Myc, His) C1qtnf3; Cors26; Ctrp3; Complement C1q tumor necrosis factor-related protein 3; Collagenous repeat-containing sequence 26kDa protein; CORS26; Secretory protein CORS26	Mouse	E. coli
	CORS26 Protein is a secreted protein of the C1q/ TNF-associated protein (CTRPs) family. CORS26 Protein involved in the LAMP1-STAT3, SIRT1/NF-魏B/p53, NF-魏B and TGF-尾1/Smad3 pathways play anti-inflammatory effects. CORS26 Protein also inhibited the expression of antimicrobial peptide (CAMP) in adipocytes induced by toll-like receptors (TLR). CORS26 Protein, Mouse (Myc, His) is the recombinant mouse-derived CORS26 protein, expressed by E. coli , with N-His, C-Myc labeled tag. The total length of CORS26 Protein, Mouse (Myc, His) is 224 a.a., with molecular weight of ~31.1 kDa.

HY-P79169

	TAFA1/FAM19A1 Protein, Human TAFA Chemokine Like Family Member 1; FAM19A1; TAFA-1; Family With sequence Similarity 19 Member A1, C-C Motif Chemokine Like; Chemokine-Like protein TAFA-1; Family With sequence Similarity 19 (Chemokine (C-C Motif)-Like), Member A1; protein FAM19A1; Famil	Human	E. coli
	The Dll3 protein is a transmembrane ligand that plays a critical role in regulating cell differentiation and patterning during embryonic development. It participates in the Notch signaling pathway and helps determine cell fate. TAFA1/FAM19A1 Protein, Human is the recombinant human-derived TAFA1/FAM19A1 protein, expressed by E. coli , with tag free. The total length of TAFA1/FAM19A1 Protein, Human is 108 a.a., with molecular weight of ~12.4 kDa.

HY-P71677

	FAM20C Protein, Human (HEK293, Myc, His) C76981; Dentin matrix protein 4; Family with sequence similarity 20 member C; GEF CK; Golgi enriched fraction casein kinase; protein FAM20C; RNS	Human	HEK293
	The FAM20C protein is a Golgi kinase that phosphorylates secretory pathway proteins and contributes to the biomineralization of bones and teeth. FAM20C phosphorylates caseins and proteins involved in biomineralization and also affects lipid homeostasis, wound healing, and cell migration and adhesion. FAM20C Protein, Human (HEK293, Myc, His) is the recombinant human-derived FAM20C protein, expressed by HEK293 , with N-His, C-Myc labeled tag. The total length of FAM20C Protein, Human (HEK293, Myc, His) is 492 a.a., with molecular weight of ~61.4 kDa.

HY-P700616

	ANO1/Anoctamin-1 Protein, Human (N-His, C-Myc) anoctamin 1, calcium activated chloride channel; oral cancer overexpressed 2, ORAOV2, TMEM16A, transmembrane protein 16A; anoctamin-1; DOG1; FLJ10261; TAOS2; oral cancer overexpressed 2; tumor-amplified and overexpressed sequence 2; discovered on gastrointestinal stromal tumors protein 1; transmembrane protein 16A (eight membrane-spanning domains); ORAOV2; TMEM16A	Human	E. coli
	ANO1/Anoctamin-1 protein, a calcium-activated chloride channel (CaCC), plays diverse roles in cellular functions. It serves as a major contributor to basal and stimulated chloride conductance in airway epithelial cells, impacting tracheal cartilage development and contributing to airway mucus expression induced by interleukins IL3 and IL8, as well as by the asthma-associated protein CLCA1. ANO1 is indispensable for normal functioning of the interstitial cells of Cajal (ICCs), crucial for electrical pacemaker activity in gastrointestinal smooth muscles, and is involved in transepithelial anion transport and smooth muscle contraction. It is also required for CFTR activation and membrane expression, modulating endoplasmic reticulum Ca(2+) store release. Additionally, ANO1 participates in calcium-activated chloride secretion in human sweat gland epithelial cells, showing increased basal chloride permeability and decreased Ca(2+)-induced chloride permeability. In sensory neurons, ANO1 acts as a heat sensor and modulates spontaneous firing patterns, contributing to calcium-activated chloride channel activity in taste cells and mediating non-histaminergic Mas-related G-protein coupled receptor (MRGPR)-dependent itching in dorsal root ganglion neurons. In the developing brain, ANO1 is essential for the Ca(2+)-dependent process extension of radial glial cells. ANO1/Anoctamin-1 Protein, Human (N-His, C-Myc) is the recombinant human-derived ANO1/Anoctamin-1 protein, expressed by E. coli , with C-Myc, N-10*His labeled tag. The total length of ANO1/Anoctamin-1 Protein, Human (N-His, C-Myc) is 87 a.a., with molecular weight of ~17.6 kDa.

HY-P71350

	TAFA4 Protein, Human (His) protein FAM19A4; Chemokine-like protein TAFA-4; TAFA4; family with sequence similarity 19 (chemokine (C-C motif)-like); member A4; FAM19A4; chemokine-like protein TAFA-4	Human	E. coli
	TAFA4 protein, a modulator of injury-induced and chemical pain hypersensitivity, influences pain responses. It serves as a ligand for FPR1, chemoattracting macrophages, enhancing phagocytosis, and elevating reactive oxygen species (ROS) release. TAFA4's multifaceted role indicates involvement in immune responses and cellular processes related to inflammation and injury. TAFA4 Protein, Human (His) is the recombinant human-derived TAFA4 protein, expressed by E. coli , with N-6*His labeled tag. The total length of TAFA4 Protein, Human (His) is 106 a.a., with molecular weight of ~16.0 kDa.

HY-P701118

	NIP30 Protein, Human (HEK293, His) FAM192A; CDA10; NIP30; CDA018; C16orf94; family with sequence similarity 192, member A; protein FAM192A; NEFA-interacting nuclear protein NIP30	Human	HEK293
	The NIP30 protein negatively regulates proteasomal protein catabolism and protein binding activity. It is located in the nucleus and is expressed in various tissues including the brain and testis. NIP30 Protein, Human (HEK293, His) is the recombinant human-derived NIP30 protein, expressed by HEK293, with C-His labeled tag. The total length of NIP30 Protein, Human (HEK293, His) is 254 a.a., with molecular weight (glycosylation form) of ~35-43 kDa.

HY-P700509

	TFF1 Protein, Human (P. pastoris, N-His) TFF1; BCEI; D21S21; HP1.A; HPS2; pNR-2; pS2; trefoil factor 1; gastrointestinal trefoil protein pS2; breast cancer estrogen-inducible sequence; Breast cancer estrogen-inducible protein; breast cancer, estrogen-inducible sequence expressed in gastrointestinal trefoil protein pS2; pS2 protein; trefoil factor, BCE1, human pS2 induced by estrogen from human breast cancer cell line M	Human	P. pastoris
	TFF1 protein acts as an endogenous repressor of isoform 1 and interacts with CHK1, antagonizing its function and promoting the transition from the S to G2/M phase of the cell cycle. TFF1 Protein, Human (P. pastoris, N-His) is the recombinant human-derived TFF1 protein, expressed by P. pastoris, with N-6*His labeled tag. The total length of TFF1 Protein, Human (P. pastoris, N-His) is 60 a.a., with molecular weight of 8.7 kDa.

HY-P70161

	LYVE-1 Protein, Human (HEK293, His) rHuLymphatic vessel endothelial hyaluronic acid receptor 1/LYVE-1, His; Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1; LYVE-1; Cell Surface Retention sequence-Binding protein 1; CRSBP-1; Extracellular Link Domain-Containing protein 1; Hyaluronic Acid Receptor; LYVE1; CRSBP1; HAR; XLKD1	Human	HEK293
	The LYVE-1 protein is a ligand-specific transporter that regulates molecular transport between the trans-Golgi network (TGN) and the plasma membrane. It plays a key role in autocrine cell growth regulation, mediating the uptake and catabolism of growth regulators through cell surface retention sequences. LYVE-1 Protein, Human (HEK293, His) is the recombinant human-derived LYVE-1 protein, expressed by HEK293 , with C-6*His labeled tag. The total length of LYVE-1 Protein, Human (HEK293, His) is 219 a.a., with molecular weight of 40-60 kDa.

HY-P72171

	DEFA1 Protein, Human (GST) alpha 1; DEF1; DEF1_HUMAN; DEFA1; DEFA1B; DEFA2; Defensin 1; Defensin; Defensin; alpha 1; Defensin; alpha 1; myeloid related sequence; Defensin; alpha 2; HNP-1; HNP-2; HNP1; HP-1; HP-2; HP1; HP2; MRS; Myeloid related sequence; Neutrophil defensin 1; Neutrophil defensin 2	Human	E. coli
	The DEFA1 protein is a multifunctional effector in innate immunity that exhibits antibiotic-like properties against bacteria, fungi, and viruses. It promotes immune defense by activating antigen-presenting cells (APCs) and inhibiting bacterial cell wall synthesis by interacting with lipid II. DEFA1 Protein, Human (GST) is the recombinant human-derived DEFA1 protein, expressed by E. coli , with N-GST labeled tag. The total length of DEFA1 Protein, Human (GST) is 94 a.a., with molecular weight of ~34 kDa.

Cat. No.	Product Name	Application	Reactivity

HY-P81409

SATB1 Antibody (YA1154)

DNA-binding protein SATB1 (Special AT-rich sequence-binding protein 1)
IHC-P Human

HY-P83515

TATA Box Binding Protein Antibody (YA3260) TBP; GTF2D1; TF2D; TFIID; TATA-box-binding protein; TATA sequence-binding protein; TATA-binding factor; TATA-box factor; Transcription initiation factor TFIID TBP subunit	WB, IHC-F, IHC-P, ICC/IF, IP	Human, Mouse

HY-P81198

AXL Antibody Adhesion related kinase; AI323647; Ark; Axl; AXL oncogene; AXL receptor tyrosine kinase; AXL transforming gene; AXL transforming sequence/gene; EC 2.7.10.1; JTK11; Oncogene AXL; Tyro7; Tyrosine protein kinase receptor UFO; Tyrosine-protein kinase receptor UFO; UFO; UFO_HUMAN.	WB; ELISA; IHC-P; IHC-F; IF	Human, Mouse(predicted: Rat, Dog, Horse, Rabbit)
AXL Antibody is an unconjugated, approximately 95 kDa, rabbit-derived, anti-AXL polyclonal antibody. AXL Antibody can be used for: WB, ELISA, IHC-P, IHC-F, IF expriments in human, mouse, and predicted: rat, dog, horse, rabbit background without labeling.

HY-P81220

ADGRE1 Antibody F4/80; Adhesion G protein-coupled receptor E1; Cell surface glycoprotein EMR1; Cell surface glycoprotein F4/80; DD7A5 7; Egf like module containing mucin like hormone receptor like 1; Egf like module containing mucin like hormone receptor like sequence 1; EGF like module receptor 1; EGF TM7; EGF-like module receptor 1; EGF-like module-containing mucin-like hormone receptor-like 1; EGFTM7; EMR 1; EMR1; EMR-1; EMR1 hormone receptor; EMR1_HUMAN; AGRE1_HUMAN; Gpf480; Ly71; Lymphocyte antigen 71; TM7LN3.	WB; ELISA; Flow-Cyt	Human, Mouse(predicted: Rat, Pig, Guinea Pig)
ADGRE1 Antibody is an unconjugated, approximately 95 kDa, rabbit-derived, anti-ADGRE1 polyclonal antibody. ADGRE1 Antibody can be used for: WB, ELISA, Flow-Cyt expriments in human, mouse, and predicted: rat, pig, guinea pig background without labeling.

HY-P81083

ADGRE1 (F4/80) Antibody (YA920) F4/80 (mouse); Adhesion G protein-coupled receptor E1; Cell surface glycoprotein EMR1; Cell surface glycoprotein F4/80; DD7A5 7; Egf like module containing mucin like hormone receptor like 1; Egf like module containing mucin like hormone receptor like sequence 1; EGF like module receptor 1; EGF TM7; EGF-like module receptor 1; EGF-like module-containing mucin-like hormone receptor-like 1; EGFTM7; EMR 1; EMR1; EMR-1; EMR1 hormone receptor; EMR1_HUMAN; AGRE1_HUMAN; Gpf480; Ly71; Lymphocyte antigen 71; TM7LN3.	WB; IP	Human(predicted: Mouse, Rat)
ADGRE1 (F4/80) Antibody (YA920) is an unconjugated, approximately 95 kDa, mouse-derived, anti-ADGRE1 (F4/80) (YA920) monoclonal antibody. ADGRE1 (F4/80) Antibody (YA920) can be used for: WB, IP expriments in human, and predicted: mouse, rat background without labeling.

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

protein sequence

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

NaturalProducts

Recombinant Proteins

Antibodies

Natural
Products